Python Sandbox

Please refer to this tutorial to find more details on the following codes.

# # This code finds multiple matches. # # "In a nucleotide sequence, find all examples of three or more As followed by a G or T." # import re line = "TAAAGCGCCGGGAGAAAAGAAAATACACAC" match = re.findall( 'AAA[GT]', line) if match: print(match) else: print("No match!") Run List